JoeMama7800
JoeMama7800 JoeMama7800
  • 20-01-2020
  • Mathematics
contestada

What is the value of x *12 points*

What is the value of x 12 points class=

Respuesta :

lLillith
lLillith lLillith
  • 20-01-2020

Answer:

59

Step-by-step explanation:

by the vertical angles thrm. 2x+24=142

(-24) on either side= 2x=118

(÷2) on either side= x=59

Answer Link
Аноним Аноним
  • 20-01-2020

Answer:

The answer is 59

Step-by-step explanation:

Answer Link

Otras preguntas

total amount = P (1 + i)t Sara borrowed $500 for four years at 3 percent interest, compounded annually. Use the formula to calculate the total amount she will
can you walk on the moon
Which aspect of Anse's narration from As I Lay Dying most clearly makes him an unreliable narrator? A. His ideas about why Addie is dying B. His insistenc
Assume this is an acceleration graph, where the X axis represents time in seconds and the Y axis represent velocity in m/s. Which statement BEST describes the a
Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----
Grains include ........ whole grains and refined, enriched grains. dark and light grains. tiny and large grains. fat and fat free grains.
How many people will become disabled during their lives? a. three in four b. one in two c. one in three d. four in five
El Grito de Dolores happened in 1821. True False
How do you know 5 1/4 is less than 5 4/10?
what 12×15??????????and don't forget to put # sammy7609