everyruvenique everyruvenique

18-02-2020
Mathematics

contestada

counting back from 5 what number follow 4

Respuesta :

ChristopherGorlinsky ChristopherGorlinsky

18-02-2020

Answer:

5 4 3 2 1

Step-by-step explanation:

is this what ur asking

Answer Link

TheLegendsOfInu TheLegendsOfInu

18-02-2020

The answer is 3. Counting backwards (In this case) would be 5, 4, 3, 2, 1. After 4, when counting backwards, comes the Number 3. So, your answer is 3.

Answer Link

Otras preguntas

What is the domain of the graph below:

Select all of the expressions that could go on the right side of the equation to make the equation have no solutions.

What is one benefit of continuing your education after graduating high school? OA. A person with a high school degree typically earns more than someone with a c

Which of the following is an observation of a chemical property? Ozinc reacts with hydrochloric acid density of wood is 0.51 g/cm³ water boils at 100°C. sand pa

original DNA: TACTTTAATCCCAAATTTACT DNA: TACTATAATCCCAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ?

find the exact value of tan(x) = -1, where 0<x<2π

Will give brainliest write a poem about the Odyssey.

Anthropology teaches us about cultural differences and similarities. The following are among the key lessons, except one. Which one of the following is UNTRUE?

NEED HELP ASAP PLEASE!!!!!!

rumana modi votes for political candidates whose rhetoric and policy initiatives while serving in office align with what she wants to be done in the future.