deshilonThornton deshilonThornton

16-03-2020
Spanish

contestada

Those who favored Hamilton's ideas made up
the

Respuesta :

Becca112905 Becca112905

18-03-2020

Answer:

Democratic Republicans

Explanation:

Answer Link

Otras preguntas

which of the following is the best example of a solidary benefit? joining a group to be with your grandmother joining a group to obtain a monetary benefit joini

A firm is thinking of hiring an additional worker to their organization who can increase total productivity by 100 units a week. The cost of hiring him is $1,50

original DNA: TACTTTAATCCCAAATTTACT DNA: TACTTTAATCGAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ?

Expository essay are usually organized by a cause/effect, a problem/solution, or a ___ structure Comparison/contrast Word choice/sentence structure voice/thesis

The following is a short section of a DNA template before replication: 3’ TACGGCTTAACC 5’ Based on your knowledge of DNA replication, which sequence would be t

Point charge q1 = 4.5 nC is at position x1 = 3 m, y1 = 4 m. Point charge q2 = 4.4 nC is at position x2 = 4 m, y2 = -4 m. What is the electric potential ener

You are going to complete some mathematical analysis to help Angie and Barry, a couple of stressed out math students, who lost a cell phone and tablet while wal

y=-2x+9 y=x-3 Is there any way to solve this algebraically? If so, what are the steps? Or you can just graph too. Preferably both.

: in the vertebrate animal adaptive immune system, the primary antibody response differs from the secondary antibody response in that . . . choose one: a. antib

Please helpUsing the diagram above and what you know about the carbon cycle, explain how a carbon atom in the atmosphere can end up in either fossil fuels or an