mtaiyebah mtaiyebah

17-07-2020
Mathematics

contestada

Attachment Below, please help, I'm not timed

Attachment Below please help Im not timed class=

Respuesta :

meredith48034 meredith48034

17-07-2020

Answer:

Step-by-step explanation:

x + 2x + 4x = 49

7x = 49

x = 7

2(7)= 14 hours he worked on Wednesday

Answer Link

VickyLiu VickyLiu

17-07-2020

14 hours on Wednesday.

Tuesday: x hours
Wednesday: 2x hours
Thursday: 4x hours

x hours + 2x hours + 4x hours = 49 hours
7x hours = 49 hours
x = 49/7
x = 7

2x = 14

Answer Link

Otras preguntas

What is the difference between uncodified and codified?

When does your personality start to develop?

What is the atomic number (Z) of an atom containing 30 neutrons and having A= 70?

A plant that produces seeds in fruits, endosperm in its seeds, and one cotyledon per seedling is most likely a member of the

If a sport shop sold 1500 dozen golf balls last week how many individual golf balls did the shop sell

Part 1: CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks :3

In a sample of 1000 u.s. adults, 180 dine out at a restaurant more than once per week. two u.s. adults are selected at random without replacement. (adapted from

Using gloves correctly means: A. Working from clean to clean B. Working from clean to dirty C. Working from dirty to dirty D. Working from dirty to clean

Take a look at the weather map. The front seen there causes short periods of storms and heavy rains. What type of front is this?

Triangle ABC is congruent to triangle DFE. Find x.