figueroamelany316 figueroamelany316

19-12-2020
Biology

contestada

What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT

Respuesta :

raduoprea160 raduoprea160

19-12-2020

Thymine(T) pairs with adenine(A)

Adenine(A) pairs with uracil(U)

Cytosine(C) pairs with guanine(G)

therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT

is

AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA

Answer Link

Otras preguntas

1. why did Britain want an empire? 2. why did the 'sun never set' on the British Empire?

Together the esophagus, stomach, and intestines are part of a what?

Ellie has 12.5 pounds of potatoes to make mashed potatoes. She uses one-tenth as many pounds of butter as potatoes. How many pounds of butter does Ellie use?

Quartz gold and calcite are examples of______ but coal is not

Sophie has 3/4 quart of lemonade. if she divides the lemonade into glasses that hold 1/16 quart, how many glasses can Sophie fill? Show your work.

Which attitude towards the colonies was the result of the British embrace of the theory of mercantilism? a. Parliament required colonists to pay taxes in suppor

write 72.4823 in expanded form

A cubic meter of elm is 600kg and a cubic meter of pine is 350kg. What is the ratio of the pine's mass to the elm's mass?

In what mountains does the Indus River originate?

list all of the prime numbers less than 20 in numerical order