mari2310
mari2310 mari2310
  • 20-01-2021
  • Mathematics
contestada

What is 3/4 divided by 2/3

Respuesta :

04alyrod75983
04alyrod75983 04alyrod75983
  • 04-02-2021

Answer:

9/8 or 1.125

Step-by-step explanation:

Answer Link

Otras preguntas

according to the declaration of independence, why are governments created?
Which of the following best describes the geography and climate of the Southeast culture area?
Presented below is the partial bond discount amortization schedule for Cullumber Corp. Cullumber uses the effective-interest method of amortization. Interest Pe
if x=10^a , y=10^b and x^b.y^a=100.prove that xy=1​
A random sample of size 100 is taken from a population described by the proportion p = 0.60. The probability that the sample proportion is less than 0.55 is ___
In which situation is a are food service workers not required to wash their hands A) After using the bathroom B) after their shift C) after handling raw fruit D
Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCC
Solve for x 2/3x-5=21
On February 1, 2014, Nelson Corporation purchased a parcel of land as a factory site for $280,000. An old building on the property was demolished, and construct
Mr. Mitchell is concerned about the problematic behavior of one student. Before submitting a formal referral for special education Mr. Mitchell will probably