4804378780 4804378780

18-02-2021
Biology

contestada

1. DNA base sequence: GACGATGTAGCATCGACCATTG.
What would the mRNA sequence for this sequence of DNA be?

Respuesta :

malakmohammed0101 malakmohammed0101

18-02-2021

CUGCUACAUCGUAGCUGGUAAC

Answer Link

Otras preguntas

Flies Mosquitoes The table shows the number of flies and the number of mosquitoes that the frog eats for two lunches. Based on the ratio, complete the missing v

For a monopolist, if price is above average total cost, the monopolist is quizlet

The _______________ is the maximum amount of available credit a cardholder may access

Complete the solution of the equation. Find the value of y when x equals 4. -3x + 9y = -57

The graph above depicts the effect of a significant increase in individual income taxes, taking them to their highest level in 50 years. Which of the following

How long will it take for 475 mg of a sample of radium-225, which has a half-life of about 15 days, to decay to 30 mg

Pls help me !!! due today:(

A block of mass 2.60 kg is placed against a horizontal spring of constant k = 725 N/m and pushed so the spring compresses by 0.0500 m. What is the elastic poten

The marine biome _______. a. is a large ecosystem, but not larger than some terrestrial ecosystems b. is characterized by four different zones c. has little spe

which of the following is the product of the rational expression shown below