jackieespi jackieespi

18-01-2017
History

contestada

1. How did the death of Archduke Franz Ferdinand instigate (urge on) the collapse of peace in Europe?

Respuesta :

liamklec181 liamklec181

18-01-2017

tensions were very high during that time period. so many alliacnces were made as well as rivalries. it was a "powder keg" and when he was killed the keg exploded

Answer Link

Otras preguntas

What do viceroy butterflies use to look like poisonous Monarch butterflies?

identify the gerund and gerund phrase in each of the following sentences?Facing his teacher was never frightening for him.gerundgerund phrase

Which expression is equivalent 4/5 - 1/3?

Sparky Corporation uses the weighted-average method of process costing. The following information is available for February in its Molding Department:________.

Chiaroscuro was first used by fifteenth century _________ painters to give the illusion of rounded forms on a flat surface.

In sheep, white is due to a dominant gene (W), black to its recessive allele (w). A white ewe mated to a white ram produces a black lamb. If they produce anothe

Which of the following is a complex sentence

Choose the PCR primer pair that will amplify the breakpoint of a deletion of the segment of DNA between lines 1and 2. 5' TCGATTCCGGAAAGCTTAGTTTCCCGGGACGTATTGCC

If y = x + 5 and y = 11 then x =

The pathogenesis of adult respiratory distress syndrome (ARDS) involves which of the following? (Select all that apply.) Injury to the alveolar-capillary membra