sydtak2005 sydtak2005

21-03-2022
Mathematics

contestada

what is an equation of a line that passes through the point (5,4) and is parallel to the line 6x-5y=15

Respuesta :

Medunno13 Medunno13

21-03-2022

Answer: y-4=1.2(x-5)

Step-by-step explanation:

Ver imagen Medunno13

Answer Link

Otras preguntas

A sledgehammer weighs 18 pounds on Earth and 4 pounds on the planet Namar. Which of the following proportions could you use to determine a 100–pound earthling's

Which of the following describes the powers held by the federal government after the Civil war ?....

Use the correct form of tener: Ustedes no __________ hambre. When entering your answers for fill in the blank and essay questions, please be sure to use accent

Part 1: CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks :3

Which types of muscle tissue would most likely be used to move food within the stomach?

Define the Nullification Act (SC)

If 2 identical forces act on 2 different sized objects, the larger object will______ the smaller object.A. accelerate more thanB. accelerate less thanC. prod

Which other things were spread along the Silk Road? (Click all that apply) Gold and Ivory Plants and Animals Religions

Which expressions are equivalent to 16x4 − 64? Check all that apply. 16x4 + 16x – 16x – 64 16x4 – 8x – 8x – 64 (4x2 + 8)(4x2 – 8) 16(x2 + 2)(x2 – 2) 4(4x4 – 8)

The process of some factors in the environment favoring individuals with one kind of allele is A. natural selection B. adaptation C. gene flow