sharidler sharidler

16-12-2022
Biology

contestada

original DNA: TACTTTAATCCCAAATTTACT DNA: TACTTTAATCGAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ?

Respuesta :

Otras preguntas

how do you convert 3 1/2 to fraction notation also 9 7/8

what were the ideals of the Renaissance and how did Italian artist and writers reflect these ideals

How is the behavior of waves affected by a medium?

What would happen if our Eyes were unable to control the amount of light that enteres them?

what makes volcanoes violent?

Yoshi and Rana serve muffins. There are 3 muffins with nuts. 1/6 of the muffins have nuts. How many muffins do they serve in all?

A box of uncooked spaghetti costs $0.1369 per ounce. How much is this cost to the nearest cent?

Suppose that you hear a clap of thunder 16.2 s (seconds) after seeing the associated lightning stroke. The speed of sound waves in air is 343 m/s and the speed

Calculate the number of moles 9.00 g of H2O 88.0 g of CO2 1.70 g of NH3

what is an various-sized particles ejected by a volcano?