sharidler sharidler
  • 16-12-2022
  • Biology
contestada

original DNA: TACTTTAATCCCAAATTTACT DNA: TACTATAATCCCAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ?​

Respuesta :

Otras preguntas

Teach me about ratios
What is 5a*2 -6a+7a*2+3a-2+8a+7= Distribute and combine like terms
Find the 8th term of geometric sequence {a_{n}, n = 1, 2, 3, . . .} with common ratio r = 0.5 and first term a_{1} = 2.
Explain how to use the distributive property to compute104x57
What expression has the value of 0.032 ?A. 3.2 ×10²B. 3.2 ×10²C. 3.2 ×10³D. 3.2 ×10³
How did movie stars help in the war effort?
one and three fourths as a percent ?
Find the 8th term of geometric sequence {a_{n}, n = 1, 2, 3, . . .} with common ratio r = 0.5 and first term a_{1} = 2.
The ratio of Sam's age to Hank's age is 5 to 3. If the sum of their ages is 24, how old is Hank?
Which of the following is NOT indicated by Mendel’s experiments? (A) incomplete dominance (B) segregation (C) recessive (D) dominant (E) independent assortment