marandajane marandajane

19-01-2023
Biology

contestada

Transribe and translate the following dna strand
GTCCTTTACCATCGATTGGAAAACGTTAAAATCCAGTTCCAT

Respuesta :

Otras preguntas

26) Why was the territory of Texas annexed by the United States? A) Spain forced Mexico to allow annexation to happen after years of conflict. B) Texas was adde

6.55743... is an irrational number because it is an a terminating decimal a repeating decimal a non-terminating and non-repeating decimal a non-repeating deci

A movie with an aspect ratio of 1.85:1 is shown as a letterboxed image on a newer 50-inch 16:9 television. Calculate the height of the image, the height of each

WILL MARK BRAINLIEST !!! HELP ! the triangles below are similar use what you know about similar triangles to find the missing side length

The scorpion has adapted to survive in a harsh desert climate . The rattlesnake has adapted to survive in a harsh desert climate . Combine the sentences into o

I'm really weak at computers can someone please help me with these questions

someone help me please!

To what extent did the Renaissance view or human nature differ from the Middle ages?

Explain how degrees of longitude are calculated .

Heeeeeeellllllllppppppppp