760sierra760 760sierra760
  • 17-08-2017
  • Mathematics
contestada

What is 99019900 in word form

Respuesta :

xPowerStaticx
xPowerStaticx xPowerStaticx
  • 17-08-2017
99,019,900 would be ninety-nine million nineteen thousand and nine hundred hundred
Answer Link

Otras preguntas

colonial powers were particulary interested in which resource that was aboundent in africa???
Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’
Find the sum of the geometric sequence. three divided by two, three divided by eight, three divided by thirty two, three divided by one hundred and twenty eig
According to the document 5, why does president polk think the U.S should extend its borders?
Unfortunately I don’t have _____ brothers, but I have a two twin sisters. got any some very
Write an inequality to represent the situation. Twelve times a number increased by four is no more thsn twenty-three.
explain the controversersy beteween russia and chechnya
There are exclusions that make the expression 8ab^2/4a^2b-8ab^2 undefined. True or False.
What is the product of 0.46 × 0.12? 0.0552 0.552 5.52 552
How old would einstein be right now