farhanabadar86 farhanabadar86

19-03-2024
Biology

contestada

An mRNA codon for the amino acid Alenine is GCC. How many Alenine molecules are present in polypeptide containing 8 amino acid code for, the following DNA template
TCGGCCTACCGGGCCCATGCCAAT

Respuesta :

Otras preguntas

what is 6-3x=-18x with the work?

How was John Adams helpful in getting the delegates to sign the Declaration of Independence? A.He used violence and threats against those opposed to independenc

what is the value of this proportion? 8/12 = 10/n

What is the purpose of controlling the environment when testing a hypothesis? 1.It allows the scientist to determine the effect of the changed variable. 2.It al

What did the slogan Fifty four forty or fight mean?

Who led the Continental Army to victory against the British and thus won American independence? A. George Washington B. Marquis de Lafayette C. Marquis de Condo

Selma spent 7/10 of her allowance on a new backpack. What percent of her allowance did she spend

What is the answer to 13 in precise detail?

Which statements describe factors that led to the decline and defeat of the Aztec Empire? Choose all answers that are correct. A. The Spanish attempt to recruit

Divide 7/15 by 3/5 A. 7/9 B. 75/21 C. 21/75 D. 7/25