Vaeoldezzi Vaeoldezzi
  • 16-12-2015
  • English
contestada

Types of things vs. types of thing

Respuesta :

Аноним Аноним
  • 16-12-2015
♥ Types of things 
The reason for this is because when saying Types as a plural, you can also say things as a plural, it makes much more sense and its pronounced correctly 
Answer Link

Otras preguntas

Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----
What is the ratio 9:189 in lowest terms?
Your body paragraphs must each have the following three components (TEE): a Topic sentence containing an element the author uses to reveal theme, A. an Extens
what is the product of (4y-3)(2y2+3y-5)
which of the following is powered by energy from earth's interior ? A. Ocean Tides B. Solar Energy C. Erosion D/.Plate Tectonics
A salesperson receives a 2.5% commission on sales. What commission does the salesperson receive for $8000 in sales?
What is significant in the movie Phoebe saw?
A federal agency created during the Reconstruction to help Civil War refugees. It primarily helped Freedmen in the South.
A diver standing on a boat, 5 ft above sea level, looks straight down and sees coral that is 18 ft below sea level. Let distance above sea level be represented
Help, It has multiple answers for this question.