kgbvcvbb kgbvcvbb
  • 20-11-2019
  • Mathematics
contestada

Any suggestions or answers

Any suggestions or answers class=

Respuesta :

orangecat14 orangecat14
  • 20-11-2019

Answer:

i belive 1 and 2 are not vertical angles

Step-by-step explanation:

Answer Link

Otras preguntas

Read the poem. The Inchcape Rock by Robert Southey The ballad of "The Inchcape Rock" retells the legend of a treacherous reef in the North Sea, of the kind
¿Cuál frase es correcta? a) me gusta estudiar español y ingles b) me gusta estudiar español e ingles 2) Cual frase es correcta? a.tengo cincuenta u ochenta e
Lanny goes to the bank and puts $4000 in a savings account. He earns a simple interest of 2.5%. If he leaves the money in the account for five years, what is th
Which part of the human respiratory system is a thin moist membranous structure where gas exchange occurs?
What distinguishes the rock cycle the water cycle the carbon cycle and the nitrogen cycle as Cycles
8 x 6/11 SIMPLIFY PLZ
What allowed for the expansion of the ranching industry a. laws created by the government prohibited cattle drivers from cutting barbed wire. b.american indians
Replicate the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’
__________ helps the reader to make sense of the information to which he/she is exposed. A.Formatting B.Length C.Organization D.Theme
What is the concentration of hydroxide ion in household ammonia, an aqueous solution of nh3 that has a ph of 11.50?