mynameischad mynameischad
  • 17-09-2020
  • Mathematics
contestada

7 (5х + 2) = 3х + 14
Need help solving

Respuesta :

cassandra4t cassandra4t
  • 17-09-2020
Answer: 0

35X +14=3X +14
35X = 3X
35X-3X=0
32X = 0 divide both sides by 32
x=0
Answer Link
awitta
awitta awitta
  • 17-09-2020
35x+14= 3x+14
35x-3x=14-14
33x=0
Answer Link

Otras preguntas

Amber Volakis was singing "Story of My Life" at the topof her lungs in the shower this morning.Long-Form WorkShort-Form Work​
A process where organisms with more favorable traits produce offspring that are more successful and become more abundant What’s it called ?
WHY does the author include the section "Concerns of Jefferson"?
Which word is a compound word? Group of answer choices A. simultaneously B. cyberbullies C. manipulating D. dependent
You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In order to d
Solve the following equation for x in terms of a and b. ax = 15 + bx
About how far is Austin, Texas from Dallas, Texas?
Spanish Help!!! Please HURRY! Listen to the speaker and then answer the questions. The person goes to school.... in a taxi. in a car. on the subway. https
(PLEASE HELP!) The central angle of a sector is 72 degrees and the sector has an area of 15.71. Find the radius.
What can you infer from the fact that people were willing to risk their lives to cross the wall prior to its removal? Many East Germans wanted to share their wa