nayely6289 nayely6289
  • 19-11-2020
  • Mathematics
contestada

what do you call a destroyed angle?
​

Respuesta :

uhmhihello
uhmhihello uhmhihello
  • 19-11-2020

Answer:

im guessing its supposed to be a riddle. So a rectangle?

Step-by-step explanation:

Answer Link

Otras preguntas

A stationary sub uses sonar to send a 1.18x10^3 hertz sound wave through ocean water. The reflected sound wave from the flat ocean bottom is 324 meters below t
How does Tammet use numbers to understand other people’s emotions?
what type of unit is unit of speed?​
A decrease in demand has led to a decrease in both price and quantity. What product would you like to say this is for your example? ____________________ Describ
GUAAUGAAACGCCUGGUAGAAGGUUGAUGC 1. List the DNA strand sequence from which the mRNA was transcribed: 2. List the complementary DNA sequence to the above DNA stra
Emily and Teresa are thinking about their desires and obligations related to their travel to Peru. Complete each of the following sentences by replacing the dir
The proof that is shown. Given: ΔMNQ is isosceles with base , and and bisect each other at S. Prove: Square M N Q R is shown with point S in the middle. Lines a
which of the following factors most distinguishes quebec from the other provinces of canada a) industrializationb) climatec) languaged) trade​
What are the steps to developing a "working thesis statement"?
elements that are anions