jrputin597 jrputin597

20-01-2021
English

contestada

what do abo's memories of iraqi food affect his actions

Respuesta :

vava1288 vava1288

02-02-2021

Answer: the memories make abo want to try to make one of his grandmother recipes

Explanation:fff

Answer Link

Otras preguntas

Plz help i only have 10 more min on test One characteristic that living things share is metabolism. Which statement best describes metabolism? Metabolism is all

What type of sentence is this and why? : For the first time in his life, Luke saw the ocean.

help me Which of the following would be a violation of the Americans with Disabilities Act? a. refusing to hire qualified applicants who have disabilities b.

A mutation occurred in the third codon position of a gene, but the protein still functions normally. how is this possible?

The end of a muscle that is attached to the point that moves when the muscle contracts is called the

When interpreting poetry, _____ reveal(s) explicit meaning and _____ reveal(s) implied meaning. -imagery / direct statements -proven fact / ambiguous statements

Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----

An adult heart pumps about ___ quarts of blood through the body. 6 3 12 15

48 cubed as a product of its prime factors

Buying used equipment can be just as safe and you can save some money. True False