xbi6e9ncdk xbi6e9ncdk

19-02-2021
Mathematics

contestada

What is the scale factor of Figure B to Figure A in the simplest form?

What is the scale factor of Figure B to Figure A in the simplest form class=

Respuesta :

Angiebean2008 Angiebean2008

20-02-2021

simple just multiply 10X25X21.5 for A and the same for B

Answer Link

Otras preguntas

Henry can build 2 birdhouses in 30 minutes. How many birdhouses can he build in four hours?

you are making cookied for a party. the recipe makes 5 dozen cookies and requires 4 cups of flour, 3 cups od chocolate chips and other ingredients. find an equi

What did John Adams and Alexander Hamilton agree on? Question 1 options: A) Neither thought democracy was a good idea. They both thought that the educated and

How do Telemachus's actions in battle compare to his father's?

Who created the first settlement in Greenland

Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----

Alex is 7 years older than Jordan.the sum if their ages is 33,how old are Jordan and Alex

To check if a stovetop is hot, you place you hand near the top of the stove and feel that it is warm without touching it. You can feel the heat from the stove t

how many ways are there to tell time on a clock after you are halfway through the hour in Spanish?

30 is 75% of what number