lovemillie65 lovemillie65
  • 19-07-2021
  • Mathematics
contestada

2) Find the missing digit for the following bank identification numbers:
a. 71100139
b. 321000 56

Respuesta :

HeelpMeeeeee
HeelpMeeeeee HeelpMeeeeee
  • 19-07-2021

Answer:

i donno  

Step-by-step explanation:

i

Answer Link

Otras preguntas

Taryn conducted a science experiment on saturation. She added sugar to a sugar-water solution at different intervals. The graph shows how much sugar was in the
what fractions are equivalent to 25/45
Adverbs can modify all of the followingexcept        A. other adverbs.   B. adjectives.   C. nouns.   D. verbs.
Fill in the corresponding mRNA sequence of the DNA strand: ATGCGCTGCACGTGCACGTT TACGCGACGTGCACGTGCAA MRNA-----
How did Francis Bacon help to popularize a new way of studying the universe?
Read the incorrect sentence. -Marco is a loyal friend he is the only one who visited me when I was hospitalized for pneumonia. How can the sentence be corrected
whose ethnic cleansing act remind the world of hitler
Which of these are electromagnetic waves? A. light and radio waves B. sound waves C. ocean waves and earthquake vibrations
I need help is it A B C or D
What is the meaning of the word episcopotamians?