njivfhb2562 njivfhb2562

21-03-2022
Mathematics

contestada

If miss Willson walked 3/4 miles each day how many did she walk in 4 days?

Respuesta :

joniqueoosthuizen2 joniqueoosthuizen2

21-03-2022

Answer:

3 miles

Step-by-step explanation:

sorry I can't explain

Answer Link

Otras preguntas

55 percent of 120 books are fictional how many are non fictional

PLEASE HELP AS SOON AS POSSIBLE!!!!20 POINTS Which version of Romeo and Juliet represented the themes in the play more effectively? The question is talking abou

____ memory is very fast memory circuitry located near the cpu that is used to speed up processing.

Evaluate 6 - 2(-1) | -5 | =

What was pink Floyds first song

Part 1: CCATAGCACGTTACAACGTGAAGGTAA Convert it into RNA List Amino Acids and do the same with CCGTAGCATGTTACAACGCGAAGGCAC thanks :3

Neap tides, relatively weak tides, occur when the Moon is in position(s) A.A B.B C. A and C D.B and D

what are two decimals with thousandths that would give 0.2 when rounded to the nearest tenth and 0.20 when rounded to the nearest hundredth?

What three political philosophies or philosophers contributed to the framework of government developed by the American Founders?

6x3 + 8x2 – 2x + 4 and 10x3 + x2 + 11x + 9