sydney8861
sydney8861
21-09-2018
Mathematics
contestada
7,272,1320 standard form
Respuesta :
sensationalsarath
sensationalsarath
24-09-2018
7,27,21,320 in Indian standard form
Answer Link
VER TODAS LAS RESPUESTAS ( 54+ )
Otras preguntas
original DNA: TACTTTAATCCCAAATTTACT DNA: TACTATAATCCCAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ?
thomas aquinas argued that philosophical reason can prove neither that god exists nor that god does not exist. true or false
determine exactly where to place a cart on the track so that it rolls down the track, flies through the air, and lands precisely at 1) the green line, 2) the re
A water tank initially contained 55 liters of water. It is being drained at a constant rate of 2.5 liters per minute. How many liters of water are in the tank a
Which of these are advantages of centralized management using directory services? Check all that apply.Role based access can organize user group centrallyconfig
What are some of the causes of stress mentioned in the article? What other events - both dangerous and non-dangerous - cause stress in the daily lives of young
The snack bar sold 75% of its inventory of bags of chips. If the snack bar still has 37 bags of chips, how many bags did they sell?
Which choice is the solution to the inequality below? 6x>72 OA. x< 12 OB. x> 12 OC. x2 72 OD. x>72
In statistics, the mode of a set of values is the value that occurs most often or with the greatest frequency. Write a function that accepts as arguments the fo
g if u.s. consumers cut their demand for imports, then other things the same exports and net exports fall
