acedbyace8158 acedbyace8158
  • 16-03-2020
  • Mathematics
contestada

PLEASE ANSWER ASAP

What are the solutions (coordinate points) to the system of equations?

PLEASE ANSWER ASAP What are the solutions coordinate points to the system of equations class=

Respuesta :

Maxone73 Maxone73
  • 16-03-2020

Answer:

x=0 & x=-2

(0,6) (-2,0)

Step-by-step explanation:

y= x²+5x+6

and

y= 3x+6

therefore

3x+6 = x²+5x+6

x²+2x=0

x(x+2)=0

x=0 & x=-2

Answer Link

Otras preguntas

Use the following image to answer the question. alt= Which section of this diagram represents the highest court that has the power to rule that a law violates
Trey needs to find the zero of the equation 9x + 2y = 18. Which describes the steps he should take? a. Substitute O for x and solve for y b. Substitute O for y
who is the father of genetics and what was his contribution?​
Reimagining. A christmas carol Scrooge and Marley
whats the value of the expression below 36÷([tex]\frac{2^{5} }{8}[/tex])+7x(3+11)?
i neeeeed a girl that is looking for true love, trust me i will love her
Please help. I'll give brainliest :) What happened to the supercontinents Columbia and Rodina? They broke up and formed into the current land masses and ocean f
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT
Rise of the Rivnyannya​
simplify 13 + 54 divided by 9 plz help :